воскресенье, 1 ноября 2015 г.

Сайт 22andxy расшифровка результатов генетических тестов

Давно сюда не писал - был занят созданием сайта для расшифровки 23andme.
На днях 23andme заявила, что возобновит предоставление результатов по здоровью для своих клиентов, однако результаты будут не столь полны как раньше т.к. FDA разрешила давать данные только по определенным заболеваниям. Цена теста подскочила до 199 долларов.
Я давно хотел сделать сайт по расшифровке, аналогичный promethease или athletigen только на русском языке и чтобы можно было использовать результаты не только 23andme но и других фирм. И вот мой сайт начал работать. Конечно пока там не так много контента и программная часть не совсем удобная, да и дизайн оставляет желать лучшего, но главное - начало положено. Буду по мере возможности что-то исправлять и улучшать.
В примере расшифровки можно посмотреть по каким SNP, что определяется. Если зарегистрироваться, и в разделе "Мое ДНК" вручную указать генотип в некоторых своих SNP, то в "ДНК особенности" появится таблица, как в примере расшифровки только для вас.
О всех ошибках, неточностях, пожеланиях и предложениях пишите мне в группу или в комментарии к этому посту.
Также начал записывать видео на youtube с обзорами 23andme, планирую развить канал на тему генетики.
Пока видео конечно скучноваты, но я думаю, как сделать следующие записи веселее)


вторник, 1 сентября 2015 г.

Генетика ожирения: не за горами генная терапия против лишнего веса

Говоря об ожирении, в основном все вспоминают США. И, конечно, не зря, в этой стране граждане с лишним весом составляют примерно 1/3 от всего населения, тогда как в России примерно 1/4, что тоже очень много. Ожирение сокращает продолжительность жизни, увеличивает вероятность диабета и сердечных заболеваний. Думаю, многие ждут чудес от генетической инженерии, которая, безусловно, поможет нам справляться с лишним весом быстро и естественно, и предпосылки к чудесам постепенно начинают появляться...


В данный момент найдено несколько генов, возможно отвечающих за склонность к избыточному весу. Открытый в 2007 ген FTO (fat mass and obesity associated - переводится как "связанный с количеством жира и ожирением") активно исследуется, т.к. согласно многим трудам, именно он бесспорно влияет на склонность к ожирению.
На сегодняшний день пока не ясен механизм по которому FTO влияет на избыточный вес. Некоторые ученые полагают, что ген регулирует склонность к обжорству и потреблению высококалорийной пищи и вообще, что ген как-то влияет на наш мозг, который принимает решения, приводящие к ожирению. В исследовании "Cohort of birth modifies the association between FTO genotype and BMI" установили что FTO по разному определяет склонность к ожирению у людей родившихся до и после Второй Мировой. Одним из возможных объяснений является то, что до Второй Мировой люди были более подвижны и всё негативное влияние гена FTO за счет физической активности значительно снижалось.
И вот недавно совместными усилиями ученых из Harvard и MIT мы, возможно, немного приблизились к пониманию как работает FTO. Как показало их исследование, неблагоприятная версия гена FTO способствует сохранению энергии из пищи в клетках в виде жира.
Участки FTO регулируют деятельность генов IRX3 и IRX5, которые, если включены, заставляют клетки сохранять энергию. Если IRX3 и IRX5 не работают, вероятность ожирения снижается. Из полученных данных следует, что для некоторых людей вероятность избыточного веса определяется не их особенностями диеты или тем, как активно они занимаются спортом, а именно склонностью клеток сохранять жир.


С помощью современных технологий можно искусственно отключить IRX3 и IRX5 и, теоретически включить механизм сжигания жира в клетках. Эксперименты на мышах показали, что вес животных с включенным IRX3 при высококалорийной диете на 15% выше, чем у подопытных с выключенным геном. Все это дает надежду, что скоро лишние килограммы можно будет убрать уколом или таблеткой, стимулирующими естественное сжигание жира.
Проверить активность IRX3 и IRX5 по данным 23andme можно с помощью rs1421085.
Каждая копия C увеличивает активность вредных генов.

вторник, 25 августа 2015 г.

23andme и тесты на отцовство

Одним из популярных поисковых запросов на тему генетических тестов является "тест на отцовство".



Но можно ли использовать услугу 23andme или подобной компании, например ftdna, для определения отцовства? Как определить отцовство дешевле и быстрее всего и насколько можно верить результатам? На эти вопросы я и попробую ответить в этом сообщении.
Вообще чтобы определить являются ли два человека родственниками, необходимо сравнить их ДНК хромосому за хромосомой. Если какой-то минимальный процент совпадает, то людей можно считать родственниками. Какой именно минимальный процент указывает на родственную связь - пока, думаю, не до конца разрешенный вопрос. В 23andme у моего самого дальнего потенциального родственника 0.12% общей по тесту со мной ДНК, тогда как с моим самым близким родственником, прошедшим тест - моей мамой у меня совпадает 50%. Но все наше ДНК это 3 миллиарда пар нуклеотидов, определить какой нуклеотид находится в каком месте во всех 3 миллиардах позиций очень дорого. 23andme и подобные дают сводку по нескольким миллионам позиций генома (конкретно 23andme укажет нуклеотиды в 5 миллионах позиций генома).
Компании, занимающиеся непосредственно тестами на отцовство, сравнивают определенные участки ДНК - маркеры. Если маркеры совпадают, делается соответствующее заключение о родстве.
Традиционные способы установления отцовства отличаются по количеству рассматриваемых маркеров. Наиболее популярными методами установления отцовства являются "полимеразная цепная реакция (ПЦР)" и "полиморфизм длин рестрикционных фрагментов (ПДРФ)", хотя есть конечно и много других.
ПЦР современнее и быстрее ПДРФ. Обычно ПЦР занимает 3-9 дней и требует небольшое количество ДНК-материала для опыта - можно использовать мазок с внутренней стороны щеки, любые клетки, однако при этом способе сравниваются участки ДНК небольшого размера и тестируется обычно 6-9 участков ДНК, что меньше чем у ПДРФ.
ПДРФ более достоверный чем ПЦР метод установления отцовства, но он требует больше генетического материала, поэтому тут, возможно, придется сдавать кровь, хотя современные технологии ПДРФ позволяют сделать тест и по мазку с внутренней стороны щеки. ПДРФ обычно занимает 10-14 дней.
Конечно фирмы, предоставляющие тесты на отцовство, могут и не называть вам применяемого метода, но если тест занимает меньше 10 дней и кровь не требуется, скорее всего, применяется менее точный ПЦР.
Точность определения отцовства в 23andme и подобных составляет 100% - вы можете сравнить каждую хромосому и увидеть сколько процентов ДНК совпадает. Для родитель-ребенок совпадает 50% ДНК, бабушка/дедушка-внук совпадает 25% ДНК. Короче для ближайших родственников определить родство можно очень точно, относительно быстро и за ту же цену, что нельзя сказать о традиционных способах определения родства. Точность тут снижается а цена повышается.


Если вы хотите предварительно прикинуть являются ли два человека родителем и ребенком, можно рассмотреть группу крови исследуемых лиц. В таблице показаны возможные группы крови ребенка при различных сочетаниях групп крови отца и матери. Если у потенциальных матери с отцом первая группа крови, а у ребенка вторая, то, скорее всего, надо рассмотреть другого потенциального отца или мать. Если у потенциальных родителей первая и вторая группы крови, тут без теста на отцовство не разобраться, т.к. у ребенка может быть любая группа.
Группа крови ребенка
Группа крови отца
II(A) III(B) IV(AB) I(O)
Группа крови матери
II(A) A/O A/B/AB/O A/B/AB A/O
III(B) A/B/AB/O B/O A/B/AB B/O
IV(AB) A/B/AB A/B/AB A/B/AB A/B
I(O) A/O B/O A/B O

Рассмотрим, представленные на рынке, фирмы, определяющие отцовство.
Сравнивать различные компании, оказывающие услуги установления отцовства, будем по следующим критериям:
-Цена
-Скорость выполнения
-Предоставление юридически значимых документов по результатам теста - очень важно для всяких судов
-Анонимность - можно ли сделать тест без ведома потенциального ребенка или отца - важно, например, для мам, которые не уверены точно от кого родили, но не хотят выставлять свои сомнения напоказ
-Распространяемость - насколько можно распространить результаты на другие отрасли, тут безусловными лидерами будут 23andme и ftdna.
Сравнивать будем следующие фирмы:
-23andme
-ftdna
-инвитро - на мой взгляд, довольно дорогая компания, но отделения есть по всей России и Украине.
-Диалайн - Волгоградская фирма установления отцовства - думаю похожая есть в любом другом городе.
С нынешним курсом доллара выигрывает типичная фирма типа диалайн, оказывающая услуги теста на отцовство. Со стороны юридической применимости ДНК теста любая отечественная фирма предлагает необходимые для суда документы, тогда как в 23andme и ftdna можно получить только информацию. Хотя на сайте ftdna предлагается воспользоваться услугами dnafindings, полученные в которой документы, можно применить в международных спорах.
Что касается анонимности, на рынке можно найти анонимный тест в российской фирме в пределах 20 -25 тыс. руб. в зависимости от региона. Видимо из-аз страха перед определенными законами, в диалайн отказываются делать тест по генетическому материалу, отличному от крови, но, полагаю, это исключение. 23andme и ftdna предоставляют средний уровень анонимности - вы не можете отправить на тест волос или окурок, нужно взять пробу слюны или мазок с внутренней стороны щеки, что не всегда можно сделать, не вызывая подозрений. Также при проведении теста 23andme или ftdna, вы получаете данные, которые можно использовать и для определения особенностей здоровья и для поиска родственников плюс, если придется столкнуться с определением отцовства повторно, например когда у ребенка 3 потенциальных отца, можно сделать тест для ребенка и для кого-то из возможных отцов, если результат окажется отрицательным,  доплатить 100$, сделав тест для второго возможного отца - не надо платить несколько раз по 20 тыс. руб.
Результаты сравнения сведены в таблицу.

23andme ftdna инвитро диалайн
Цена* 230$ 200$ 40-60 тыс. руб. 15-30 т.р.
Скорость
выполнения
1.5-2 месяца 2-2.5 месяца ускоренный -
до 8 дней
до 30 дней
Юридическая
применимость
Нет Есть, но на отдельном
сайте за отдельную плату (425$),
в РФ скорее всего
неприменимо
Есть Есть
Анонимность Средняя Средняя Высокая,
по необходимости
Нет
Распространяемость Высокая Высокая Отсутствует Отсутствует

*Цены указаны на август 2015

Вообщем оставайтесь верными друг другу, чтобы вопрос отцовства вас не волновал.

воскресенье, 2 августа 2015 г.

Интеллект определяет продолжительность жизни

Научные исследования на тему умственных способностей показывают, что у людей с высоким уровнем интеллекта выше продолжительность жизни. Однако пока не до конца ясна причина такой корреляции. Возможно умные люди имеют социальный статус, который позволяет им лучше следить за здоровьем, а возможно что в таком совпадении замешана генетика, влияющая и на интеллект и на долголетие, а может вообще все сразу. 
Причину корреляции и попытались выяснить авторы недавно опубликованной научной статьи "The association between intelligence and lifespan is mostly genetic".
Исследуя однояйцевых и многояйцевых однополых близнецов, ученые выяснили, что связь между интеллектом и продолжительностью жизни на 95% регулируется генами.


После анализа данных было установлено, что более смышленый близнец обычно живет дольше. Причем данная тенденция была более явной у многояйцевых близнецов.
Тем не менее связь между интеллектом и продолжительностью жизни хоть и есть, но очень мала, поэтому при наличии большого IQ не спешите обзаводиться вредными привычками.
Автор работы Rosalind Arden считает, что гены делающие нас умнее, делают нас более здоровыми.
Безусловно, требуются дальнейшие исследования для установления деталей явления.
23andme предоставляет следующий SNP для характеристики интеллекта:
rs363050 - AG - обычный IQ, AA - IQ в среднем выше на 3-4 пункта, GG - IQ на 3-4 пункта ниже чем у AG. 
Авторы исследования, где участвовали данные rs363050 оценили влияние данного параметра на разброс в значениях IQ всего в 3,4%, поэтому серьезно к этим данным относиться не стоит. Исследовались данные индивидов с европейским происхождением.

суббота, 11 июля 2015 г.

Крейг Вентер

Как я уже писал, за последние 20 лет в генетике произошли мало освещаемые открытия по значимости сопоставимые с полетом человека в космос или на Луну. Тут есть и свои малоизвестные Гагарины с Армстронгами.
Одним из известных ныне здравствующих деятелей в области генетики является Craig Venter. Этот человек был в числе ученых, участвовавших в первом в истории секвенировании генома живого организма в 1995. Секвенировали тогда геном гемофильной палочки а также геном организма Mycoplasma genitalium.


Кроме того, Venter принимал участие в приближении первого секвенирования человеческого генома, которое окончательно было выполнено к 2003.
После 2003 Venter в рамках всемирной экспедиции по исследованию ДНК мирового океана (Global Ocean Sampling Expedition) занимался изучением разнообразия геномов организмов, обитающих в мировом океане. Экспедиция была анонсирована самим Вентером в марте 2004. От берегов Канады стартовала принадлежащая ученому яхта, которая, сделав кругосветное путешествие, вернулась к берегам США в январе 2006. По пути экспедиция брала образцы живых организмов из океана и секвенировала их геномы.
С 2006 этот предприниматель/ученый возглавляет институт имени себя (J. Craig Venter Institute), в котором занимаются различными исследованиями в области генетики.
С марта 2014 года Вентер совместно с Peter Diamandis и Robert Hariri основали компанию "Человеческое долголетие" (Human longevity). Цель компании состоит в повышении продолжительности жизни и работоспособности человека.
Короче говоря, Вентер очень яркая персона в мире ДНК.
Теперь особенно крутые достижения Вентера. В 2003 году ученый с коллегами за 14 дней воссоздали ДНК вируса Phi X 174. Полученную ДНК ввели в бактерию, тем самым имитируя заражение клетки, которая создала вирус Phi X 174. Образовавшийся вирус вел себя как настоящий - размножился и убил все бактерии в исследуемом пространстве. Геномы вирусов синтезировали и до 2003 года, но обычно такой синтез занимал несколько лет и полученные последовательности имели ошибки.


Следующим прорывным успехом Вентера стало создание "синтетической клетки" в 2010. Суть успеха состояла в замене оригинального генома в клетке Mycoplasma capricolum на полученную синтетическим путем ДНК. Организм, полученный в результате эксперимента, был назван Mycoplasma laboratorium.
Синтетическая ДНК незначительно отличалась от оригинальной - в ней содержались "водяные знаки" - зашифрованные в коде ДНК имена 46 ученых, принимавших участие в эксперименте, таблица для алфавита, в котором были зашифрованы сообщения, три цитаты и секретный адрес электронной почты бактерии. "Водяные знаки" (watermarks) использовались чтобы в последующем убедиться, что в бактериях было именно синтезированное ДНК, а не естественное, которое могло попасть в клетку случайно.
Вот 3 цитаты, зашифрованные в коде искусственной ДНК:
  1. Жить, ошибаться, терпеть неудачи, побеждать, воссоздавать жизнь из другой жизни. (TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE) -- James Joyce.
  2. Видеть вещи не такими, какие они есть, а такими, какими они могли бы быть. (SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE) -- из книги American Prometheus.
  3. То, что я не могу построить - не могу и понять. (WHAT I CANNOT BUILD, I CANNOT UNDERSTAND) -- Ричард Фейнман.
Успех пересадки искусственной ДНК в клетку трудно переоценить. Своим достижением Вентер с коллегами дали человечеству инструменты для создания новых организмов, которые, например, можно использовать для получения топлива или для очистки чего угодно от чего угодно и для всего, что только можно вообразить. Одним из направлений деятельности Вентера сейчас как раз является создание таких организмов.
В книге Вентера "Жизнь со скорость света" (Life at the speed of light) ученый рассказывает про "биологическую телепортацию". Смысл явления состоит в том, что на одном конце (например на Марсе) мы имеем ДНК секвенатор с передатчиком, а на другом (например на Земле) имеем приемник с устройством для создания ДНК по полученной приемником последовательности. Предположим на Марсе робот нашел жизнь - каких-то микробов. Чтобы отправить фрагмент ДНК с Марса на Землю потребуется куча денег и минимум несколько недель. Вместо этого ДНК секвенатор секвенирует геном найденного организма, компьютер шлет полученную последовательность ДНК на Землю, где ученые, возможно, смогут воссоздать организм по последовательности ДНК. Операция пересылки ДНК как информации займет несколько минут и ее цена будет ничтожна по сравнению с доставкой целого марсианского фрагмента на Землю.


Сейчас Вентер работает над увеличением продолжительности здоровой жизни человека. К 2020 Вентер в рамках одного из проектов планирует секвенировать 1 миллион человеческих геномов, которые помогут нам глубже понять природу различных болезней.
Имя ученого в виде CRAIGVENTER, зашифрованное в геноме Mycoplasma laboratorium, представляет следующую последовательность нуклеотидов:
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

пятница, 19 июня 2015 г.

23andme и первый миллион клиентов

Сегодня на почту пришло письмо, подписанное одной из основательниц 23andme Анне Войжитски, которое радостно сообщало, что на прошлой неделе 23andme провела генетический тест для своего миллионного клиента.
В письме меня поздравили, что я являюсь частью того миллиона, который способствует изменению мира. Было очень приятно.
Также сообщение приводило несколько фактов о времени когда еще не был протестирован ни один клиент 23andme.
Миллион протестированных клиентов назад участники конференции "American Society of Human Genetics" были шокированы сообщением о генетическом тесте, который бы давал информацию пациенту напрямую.
Миллион протестированных клиентов назад не было известно как люди прореагируют на информацию из генетических тестов. Как показывают исследования, пользователи тестов не реагируют на свои результаты слишком остро.
Миллион протестированных клиентов назад не было законов, регулирующих доступ к персональной генетической информации. Сейчас такие законы появились во многих странах.

Меня также порадовали, что в протестированном миллионе я стою по номером 794,981.


Кто находится под номерами от 1 до 100 пока загадка, единственное что известно - Анне Войжитски под номером 60.

пятница, 12 июня 2015 г.

От РНК к протеинам


После поста Подробнее об РНК, вы знаете, как организм получает РНК а также мРНК. мРНК это что-то вроде рецепта, который используют клетки для приготовления нужных им химических веществ - протеинов. В этом сообщении речь пойдет о том, как этот рецепт клетками читается и исполняется.
Чтобы что-то готовить нужны ингредиенты. Организм использует аминокислоты в качестве ингредиентов для протеинов. Все протеины в нашем теле получаются комбинацией из 20 различных аминокислот. Также как основными компонентами ДНК являются 4 нуклеотида A, T, G и С, основные составляющие протеинов - 20 аминокислот:
ГлицинGlyG
АланинAlaA
ВалинValV
ИзолейцинIleI
ЛейцинLeuL
ПролинProP
СеринSerS
ТреонинThrT
ЦистеинCysC
МетионинMetM
Аспарагиновая кислотаAspD
АспарагинAsnN
Глутаминовая кислотаGluE
ГлутаминGlnQ
ЛизинLysK
АргининArgR
ГистидинHisH
ФенилаланинPheF
ТирозинTyrY
ТриптофанTrpW
Таблица скопирована с википедии, как видите, у каждой аминокислоты есть два обозначения: из трех букв (второй столбец) и из одной буквы (последний столбец).
Но как сопоставить 4 буквы в коде РНК 20-ти аминокислотам?
Первая часть центральной догмы (о которой я писал тут) это транскрипция РНК из ДНК, вторая часть центральной догмы состоит в получении протеинов из мРНК и называется трансляцией. Трансляция в нашем организме осуществляется рибосомами. Рибосомы способны читать последовательность мРНК и создавать на основе прочитанного аминокислоты.


Одной из научных загадок XX века было понять как рибосома читает код мРНК. Если бы рибосома выдавала одну аминокислоту для одной буквы кода мРНК, то она могла бы создать только 4 различных аминокислоты, если бы одну аминокислоту кодировали 2 буквы генетического кода, то все различные комбинации дали бы нам 16 аминокислот, но рибосомы производят 20 разных аминокислот. Очевидно, чтобы закодировать 20 аминокислот 4 буквами необходимо, как минимум, использовать комбинацию из трех букв на одну аминокислоту. В действительности так и есть: чтобы создать одну аминокислоту, рибосома читает 3 буквы кода мРНК. Причем читает она по 3 буквы друг за другом. В начале изучения трансляции высказывались гипотезы, что имеет место перекрытие (overlaping) при чтении рибосомой мРНК. То есть последний или два последних нуклеотида в тройке, кодирующей аминокислоту, являются первыми в следующей тройке. Гипотеза оказалась неверной.



Тройка нуклеотидов, кодирующая аминокислоту, называется кодоном. Количество комбинаций, в которых можно расположить 4 нуклеотида в кодоне равно 4*4*4=64. Перед вами таблица, в которой для каждой комбинации A, U, G и C приведена кодируемая аминокислота:

Некоторые аминокислоты кодируются сразу несколькими кодонами, как, например, лейцин (Leu). Комбинация AUG является сигналом для рибосомы о необходимости начать кодирование аминокислот и одновременно о создании метионина (Met). Три кодона отвечают за остановку процесса трансляции - обозначены в таблице STOP (UAA, UAG и UGA), читая эти комбинации, рибосома никаких аминокислот не создает.
На поиск этой таблицы наука потратила многие годы, и сейчас вы за каких-то пару минут можете изучить результат этой долгой и кропотливой работы.
Со всеми определениями, которые я использовал в этом и предыдущем сообщениях об РНК очень легко запутаться. Поэтому, повторим:
Центральная догма молекулярной биологии гласит: сначала происходит транскрипция РНК из ДНК, а потом трансляция полученной РНК в протеины. Транскрипция РНК происходит в ядре клетки, где с необходимого гена ДНК создается копия в виде РНК, из которой в процессе сплайсинга удаляются интроны, а оставшиеся экзоны образуют матричную РНК (мРНК), участвующую в трансляции.
Трансляция происходит с помощью рибосом, которые считывают мРНК по 1 кодону за раз. Каждый кодон либо кодирует аминокислоту либо является сигналом для рибосомы прекратить трансляцию. Кодон, указывающий о необходимости начать кодирование аминокислот и, одновременно кодирующий метионин, имеет комбинацию AUG. Кодоны, указывающие на остановку трансляции, это UAA, UAG и UGA. То есть, если рибосома прочитает комбинацию UCU-AUG-GGA-UGA, на выходе будет протеин со следующими аминокислотами: Met-Gly.
Если вы поняли смысл последних предложений, поздравляю, вы знаете очень много определений, это большой повод для гордости.
Теперь немного цифр. Человеческий геном состоит из примерно 3-х миллиардов пар нуклеотидов. Ученых долго волновал вопрос: "А сколько генов, кодирующих протеины содержится в нашем геноме?" Некоторые делали догадки. Разброс во мнениях был очень приличным - минимальное предположенное количество генов было 25 тысяч, максимальное 250 тысяч. В конце концов, оказалось, что количество генов, кодирующих протеины, в человеческом геноме лежит между 20 и 25 тысячами. Это относительно не очень большое число, оно сравнимо с количеством генов у мух дрозофила и у круглых червей. Для сравнения у одного из видов тополя более 70 тысяч генов.


Но человеческий организм гораздо сложнее организмов ленточного червя, дрозофил и тополей, поэтому сложность организма определяется далеко не количеством генов, кодирующих протеины. Также сложность не определяется количеством пар нуклеотидов в геноме - у одноклеточных амеб около 650 миллиардов пар.
Менее двух процентов человеческого генома участвует в кодировании протеинов. Однако, примерно 80% генома переводится в РНК путем транскрипции. Некоторые, полученные транскрипцией, молекулы РНК в наших клетках также выполняют роль регуляторов, например, активности мРНК, еще некоторые виды РНК являются составляющими для строительства рибосом (рибосомная РНК - рРНК). Более того, в определенных клетках транскрипция РНК происходит с обеих составляющих спирали ДНК, при этом РНК, полученная с помощью одной части спирали ДНК, используется для трансляции, а полученная с помощью второй части - для регулирования каких-то процессов организма.
Короче говоря, принцип работы генома чрезвычайно сложен, и некоторые вопросы до сих пор не решены.

Проверь свои знания

1. Процесс создания клеткой РНК по ДНК называется
  • Трансляция
  • Транскрипция
  • Сплайсинг
  • Генотипирование
2. Процесс создания протеинов из мРНК называется
  • Трансляция
  • Транскрипция
  • Сплайсинг
  • Секвенирование
3. мРНК образовано
  • Экзонами
  • Интронами
  • Аминокислотами
  • Протеинами
4. Какая последовательность нуклеотидов мРНК создаст протеин из следующих аминокислот Met-Tyr-Pro-Leu?
  •  CGACUCAUGUAUCCUCUCUGAUGGUGU
  • ACUCGAUGUAUCCUCUCUGAUGGUGUС
  • ACUCGCAGUUAUCCUCUCUGAUGGUGU
  • ACUCGCAUCUAUCCUCUCUGAUGGUGU

Результат =

Правильные ответы:
Free JavaScripts provided

воскресенье, 24 мая 2015 г.

Генетическая инженерия: новый шаг к сверхчеловеку

Думаю, многие помнят клонирование овечки Долли. Успех этого эксперимента стал прорывом в области генетической инженерии. Но Долли родилась в далеком июле 1996 года и с тех пор прошло почти 20 лет, за которые в генетике случились новые важные открытия. Например, совсем недавно была опубликована научная статья, описывающая исследование, в ходе которого был искусственно изменен геном эмбриона человека (оригинал статьи на английском). Примененная для изменения технология называется CRISPR/Cas9. Она основана на способности бактерий противостоять вирусам.
Вирусы внедряют в клетки собственную ДНК или РНК, по которой клетка сама начинает производить необходимые вирусу вещества.


В некоторых бактериях осуществлен следующий механизм защиты от вирусной ДНК (очень примерно):
1 когда бактерия обнаруживает вирусную ДНК, она производит 2 типа РНК, один из которых может соединяться с вирусной ДНК
2 Эти два типа РНК и, присоединенная к одному из них, вирусная ДНК попадают в протеин, называемый Cas9, который умеет разрезать вирусную ДНК
3 По разрезанной вирусной ДНК уже нельзя создать вредные химические вещества - действие вируса нейтрализовано.
Такой механизм защиты начали исследовать примерно в 2005, далее сначала в 2010 в Science, потом в 2012 в Nature вышли статьи, проливающие свет на природу явления. В 2013 была разработана CRISPR/Cas9.
Основным преимуществом CRISPR/Cas9 является возможность изменять сразу несколько генов за раз, благодаря чему технология открывает горизонты для быстрого, точного и дешевого искусственного изменения ДНК. Все это вызвало много споров вокруг этической стороны применения CRISPR/Cas9 для совершенствования генома. Многие ученые бьют тревогу, что технология дает слишком много свободы, которую будут использовать не по назначению. В упомянутой выше статье эксперимент шел над эмбрионом, которому не было суждено родиться, так что этого сверхчеловека мы не увидим, но, думаю, не за горами применение технологии на эмбрионах - будущих людях. Просто представьте, скоро ваш ребенок появится на свет, и вы за некоторое время до рождения выбираете его цвет глаз, волос, рост, указываете ползунком какие у него должны быть умственные способности... Звучит сюрреалистично - мне напоминает фильм Гаттака, но, похоже, это вполне реальное будущее.


Вообще применять CRISPR/Cas9 можно и для более приземленных вещей, например, можно лечить им ВИЧ. Кстати, если у вас есть результаты 23andme (о том, как их получить), можно проверить I3003626 и узнать стойки ли вы к некоторым формам ВИЧ (если у вас DD - вы стойки к ВИЧ, если что-то другое не стойки). Еще с помощью CRISPR/Cas9 лечат от муковисцидоза - не знаю, что это за болезнь, но по результатам 23andme тоже можно узнать есть ли у вас вредные, вызывающие недуг, мутации (здесь не привожу анализ raw data от 23andme, т.к. нужно проверить слишком много SNP). Также технологией CRISPR/Cas9 лечили аутизм, правда пока только у обезьян и только в научных целях, лечили мышечную дистрофию у мышей. Возможности CRISPR/Cas9 продолжают применять для поиска лечения рака и в целом ряде научных приложений.
Плюс ко всему уже появились несколько стартапов, которые собираются использовать CRISPR/Cas9 для лечения всего, что только можно придумать на генетическом уровне (intelliatx.com crisprtx.com). Дальновидные инвесторы уже вкладывают туда свои миллионы.
Согласно научно-популярным статьям, CRISPR/Cas9 дает возможности, ограниченные только нашим воображением, и мы должны использовать их максимально аккуратно.
Будущее наступило уже сегодня.

понедельник, 11 мая 2015 г.

23andme и диета

Сижу на трех диетах - двумя не наедаюсь!
Анекдот

Продолжая тему здоровья, в этом посте расскажу про диету по результатам 23andme.
Первое, что хотелось бы упомянуть - это ресурс dnafit.com, тут обещают подобрать диету и программу тренировок по данным от 23andme или можно заказать набор для сбора ДНК прямо у самой dnafit. Я поначалу клюнул на рекламу и даже собирался в будущем заказать анализ у этой фирмы.
Погуглив, обнаружил, что у ресурса довольно много положительных отзывов, настолько много, что даже стало подозрительно. В основном пишут, что "ресурс предоставил данные именно для меня" - "похудел на 5 кило за месяц" и т.д. Потом почитал этот обзор, в котором автор также заявил, что некоторые рекомендации от dnafit для него были весьма уместными, однако ресурс не предоставляет никаких ссылок на научные исследования, на основе которых рекомендации были сделаны. Например, в 23andme есть ссылки на все научные первоисточники, и можно посмотреть в каком журнале опубликовано исследование, сколько людей принимало участие в исследовании, можно поискать повторялось ли это исследование другими учеными, и на основе всего сделать вывод, насколько можно верить предоставляемым результатам. Автор также отметил, что некоторые рекомендации dnafit носили расплывчатый характер. В целом автор остался ресурсом доволен, но рекомендовать бы его знакомым не стал.
Комментарии к посту расставили точки над i. Во-первых, некто с ником rg заявил, что он вместе с женой воспользовался услугами dnafit и им пришли одинаковые результаты, несмотря на значительные этнические различия супругов, более того, пара скриншотов из поста также совпадала с данными, предоставленными rg. Во-вторых в комментариях отписался некто Jie Huang, MD PhD - будто бы кандидат медицинских наук, который опубликовал свое письмо в dnafit с требованием возврата денег, и вопросами о том, на основе каких научных трудов ему были сделаны рекомендации. Еще один комментарий утверждал, что результаты очень расплывчатые. Общий вывод о ресурсе на основе комментариев к обзору у меня сложился не очень радужный, плюс цена неоправданно высока, например, за составление диеты по данным 23andme dnafit сдерет от 49 до 99 фунтов и это без программы тренировок, за которую надо будет доплатить 49 фунтов за Lite вариант и 79 фунтов за Pro версию. Учитывая, что фунт примерно в 1,5 раза дороже доллара, цены явно тут завышены. Есть еще несколько сервисов, подобных dnafit. Но, полагаю, там везде одно и то же.
Среди всех ресурсов, предоставляющих обработку данных 23andme, я пользовался https://promethease.com и https://www.athletigen.com/ и парой сайтов, предоставляющих генеалогическую информацию. www.athletigen.com/ на данный момент бесплатен, анализ на promethease.com стоит 5$.
Впечатления от https://www.athletigen.com/ у меня остались хорошие. Основной, на мой взгляд, плюс ресурса в том, что он бесплатен, хотя, вполне возможно, в будущем это изменится. athletigen.com указывает все SNP, на основе которых были сделаны рекомендации, однако ссылок на научные источники не предоставляет. Все результаты разделены по научной достоверности (scientific confidence) на три группы (1/3, 2/3, 3/3). 1/3 - самая низкая достоверность, 3/3 - самая высокая достоверность. Подробно на ресурсе останавливаться тут не буду, покажу лишь данные по диете (помимо которых athletigen.com/ дает информацию по спортивным особенностям - выносливость, сердечный ритм, склонность к травмам и т.д. и психологическим данным - склонны ли вы искать что-то новое, активно тренироваться).
Информация, которая нас интересует находится в Nutrition.
Раздел общий обмен веществ (General Metabolism) содержит два подраздела:
  1. Общая диета (General diet) - анализируются данные gо двум SNP, которые есть в отчете 23andme. Что говорит 23andme по этим SNP написано ниже:
  • Дневное потребление калорий (Daily caloric intake levels) rs5082 - индивиды с GG потребляют в день в среднем больше калорий (видимо, переедают), чем индивиды с AA или AG. Научная достоверность 2/3.
  • Реакция на диету (Response to dieting) - SNP rs1042714. GG или CG диета для вас более результативна, чем для носителей CC. Научная достоверность 1/3

  1. Предрасположенность к ожирению и повышенному индексу массы тела (Susceptibility to obesity and higher BMI). Анализируется 3 SNP - ни один из которых не совпадает с рассматриваемыми на тему ожирения в 23andme.

Следующий большой раздел посвящен основным питательным веществам (Macronutrients), содержит пока очень скудную информацию о реакции организма на углеводы (Carbohydrate) и жиры (Fat).


Последний раздел посвящен веществам необходимым организму в небольших количествах (витамины и минералы - железо, кальций, марганец...). Сюда включены данные по метаболизму фолиевой кислоты, Omega-3, кофеина а также витаминов B12 и D.


По диете от athletigen.com/ всё. Еще раз - сервис хороший, рекомендую.

Данные, которые предоставил promethease.com касались и диеты и здоровья и реакции на лекарства и особенности организма - в общем полный комплект. Но результаты были очень сумбурные. Например, 23andme при подсчете склонности к какой-либо болезни учитывает все SNP, которые, согласно наблюдениям, на болезнь влияют и выдает конечный результат в виде вероятности болезни у вас, и насколько эта вероятность выше или ниже у среднего человека, в результатах promethease.com приведены все SNP сразу, и разбираться повышена у вас вероятность заболеть чем-то или нет надо все равно надо самостоятельно учитывая данные всех предоставленных SNP. Результаты по диете от promethease совпадают с данными от snpedia, которые я привел ниже.
Теперь о том, что говорит по диете сама 23andme.
В отчете 23andme приводятся данные по трем SNP.

Результаты по первому SNP rs1801282 основаны на исследовании влияния мононенасыщенных жиров на организм. Индивиды хотя бы с одной G в этом SNP могут похудеть на "средиземноморской диете". Результаты применимы к европейцам.
rs1801282GG - Безжировая диета приведет к увеличению размера талии.
Тогда как диета с высоким потребление мононенасыщенных жиров приведет к снижению индекса массы тела
CG = GG - Безжировая диета приведет к увеличению размера талии.
Тогда как диета с высоким потребление мононенасыщенных жиров приведет к снижению индекса массы тела
CC - Диета с высоким потреблением мононенасыщенных жиров, скорее не будет иметь эффекта на индекс массы тела или размер талии.

Второй SNP rs5082 также применим к европейцам, т.к. исследовались именно они (3500 человек). Наличие двух G в этом SNP повышает вероятность ожирения при высоком потреблении насыщенных жиров.
rs5082GG - Высокий риск ожирения при диете с большим потреблением насыщенных жиров
CG - Обычный риск ожирения при диете с большим или маленьким потреблением насыщенных жиров
CC = CG Обычный риск ожирения при диете с большим или маленьким потреблением насыщенных жиров

Данные по третьему SNP rs662799 тоже подходят к европейцам. Наличие двух A повышает вероятность повышения индекса массы тела при потреблении пищи, в которой более 30% энергии находится в виде жиров.
rs662799AA - Высокая вероятность повышения индекса массы тела при диете когда более 30% энергии организм получает из жиров. (При диете, когда организм получает меньше 30% из жиров, увеличение индекса массы тела не наблюдалось)
AG - Потребление жира не влияет на индекс массы тела 
GG = AG - Потребление жира не влияет на индекс массы тела

И последнее - советы по диете с сайта snpedia.com. В разделе Weight Management snpedia приводит следующие SNP и выбор диеты:

Лучше сбалансированная диета, если:
rs1801282(C;C) и rs1042714(G;G)

Лучше диета с низким содержанием насыщенных жиров и средиземная диета если:
rs1801282(C;G) и rs1042714(C;C)
rs1801282(C;G) и rs1042714(C;G)
rs1801282(G;G) и rs1042714(C;C)
rs1801282(G;G) и rs1042714(C;G)

При следующей комбинации пока не ясно какая диета лучше. Можно попробовать либо средиземную диету либо диету Аткинса если:
rs1801282(G;G) и rs1042714(C;C)
rs1801282(G;G) и rs1042714(C;G)

Пока все, ешьте и худейте.

четверг, 9 апреля 2015 г.

Подробнее об РНК

В этом посте возвращаюсь к теории как именно ДНК влияет на наши особенности. Из предыдущего сообщения известно, что рибонуклеиновая кислота (РНК) это что-то вроде промежуточного элемента между хромосомами, в которых находится генетическая информация, и рибосомами, которые эту информацию интерпретируют.
Для тех кто не знаком с моим блогом, чтобы войти в курс дела, советую прочитать предыдущие посты в таком порядке:
1 Что такое ДНК
2 О ДНК и геноме
3 Как работает геном
Но что представляет собой РНК?
Из первого сообщения известно, что структура ДНК это двойная спираль, в которой два ряда нуклеотидов находятся друг напротив друга. РНК по строению схожа с ДНК, но есть пара отличий:
Во-первых, в РНК только один ряд нуклеотидов
Во-вторых вместо тимина в РНК находится урацил (обозначается U).


С химической точки зрения РНК состоит из нуклеотидов, тогда как ДНК из дезоксинуклеотидов. Нуклеотиды отличаются от дезоксинуклеотидов наличием дополнительного атома кислорода в структуре. Эти детали нас мало волнуют, поэтому дезоксинуклеотиды мы свободно зовем нуклеотидами, хотя они и отличаются.
Т.к. РНК состоит из нуклеотидов, она может присоединиться к половине ДНК или к самой себе, при этом урацил комплементарен аденину, т.е. может с ним соединяться. Когда РНК выходит из ядра клетки, она представляет собой не вытянутую длинную молекулу, а может соединится сама с собой, как на рисунке:


Теперь о том как РНК образуется с помощью ДНК.
Первым делом, клетка находит начало интересующего ее участка интересующей хромосомы (или просто гена). Процесс поиска в клетке происходит с помощью протеинов. Затем в интересующем участке начинается распрямление двойной спирали ДНК. Далее протеины разделяют раскрученную спираль ДНК на две составляющие. После разделения ДНК в нужном участке, начинает работу строитель РНК - РНК полимераза, которая присоединяет нуклеотиды (UACG) к нуклеотидам раскрученной ДНК, образуя длинную молекулу РНК.


Процесс получения РНК по ДНК называется транскрипцией.
Участок ДНК,  говорящий протеинам где надо начинать транскрипцию, называется промотор.
Созданная РНК не вся интерпретируется рибосомами для создания протеинов. В полученной в результате транскрипции РНК есть два типа участков: интроны и экзоны. В результате явления под названием сплайсинг все экзоны объединяются в одну РНК, которая и используется при кодировании протеинов. Такая РНК называется матричная РНК обозначается мРНК (в английском варианте messenger RNA - mRNA). Вообще у РНК много разных префиксов, говорящих о ее назначении. Схема процесса получения мРНК:


Некоторые гены содержат только один экзон, но таких генов немного. Во многих генах суммарная длина интронов в несколько раз превышает суммарную длину мРНК. Плюс к этому далеко не весь код мРНК используется рибосомами для создания протеинов.
Отсюда и возникает столько маленькая цифра: меньше 2% нашего генома представляет собой код для получения протеинов.

воскресенье, 29 марта 2015 г.

23andme и ожирение


Уверен, большинство людей интересует как использовать результаты 23andme для оценки предрасположенности к ожирению, подбора индивидуальной диеты и упражнений или хотя бы для каких-то рекомендаций касаемо еды. Мне эта тема тоже весьма интересна. В этом посте опишу, что можно узнать по данным 23andme о вашей склонности к ожирению.
Есть многообещающие заявления, что сейчас активно ведутся исследования как гены связаны с ожирением и вот вот в этой области наступят большие прорывы, однако, к сожалению, пока данные представлены, на мой взгляд, как-то сумбурно, и не совсем понятно как их воспринимать.
Одним из показателей находится ли ваш вес в допустимом диапазоне является индекс массы тела (ИМТ - в английском body mass index BMI), можете посчитать прямо тут:
Вес в кг:
Рост в см:

Ваш индекс массы тела:
Это значит:
Многие научные исследования привязаны именно к этому параметру. Если ИМТ у вас превышает 30, то, считается, что у вас ожирение.

При ожирении в 7 раз увеличивается вероятность заболеть сахарным диабетом второго типа, в 3 раза больше вероятность появления камней в желчном пузыре, в два раза выше вероятность коронарной недостаточности и тромбоза по сравнению с людьми с нормальным весом (индекс массы тела 18,5 - 25). Наибольшее влияние на ожирение оказывает именно генетика, в 64-84% случаев ожирение происходит в результате наследственности.
В одном из постов блога 23andme ссылается на работу в Nature Genetics, в которой rs6232 и rs10515237 можно использовать для определения склонности организма к ожирению. Если в rs6232 у вас TT, у вас обычная склонность к ожирению, наличие C в этом SNP увеличивает вероятность ожирения в 1,34 раза.
Наличие AA в rs10515237 не увеличивает вероятность ожирения, тогда как наличие G в этом SNP увеличивает вероятность ожирения в 1,22 раза. Результаты применимы для людей с европейским происхождением.
Указанные SNPы не входят в отчет по ожирению от 23andme. В своем отчете по рискам различных заболеваний 23andme использует для ожирения rs3751812 и rs10871777. Для rs3751812 люди с GG обладают наименьшей склонностью к ожирению, тогда как обладатели TT в этом SNP весят в среднем на 2 кг больше, T в этом SNP повышает склонность к ожирению.
Для rs10871777 в плане ожирения наиболее удачным оказывается вариант AA, тогда как наличие G повышает склонность к ожирению. Снова замечу, что исследования продолжаются и ученым пока не ясно, например, как ген FTO, в котором содержится rs3751812, влияет на ИМТ.
rs10871777 влияет на ген MC4R, хоть и в нем не находится, тогда как ген MC4R связывают с тяжелыми формами ожирения. В одном из исследований выявлено, что rs10871777 больше влияет на вес в детском возрасте чем во взрослом. Имеются данные, что у взрослых этот SNP влияет на величину роста. Пока ученым не известен механизм по которому данный SNP влияет на ИМТ.
Помимо склонности к ожирению по своим генетически результатам можно узнать есть ли у вас склонность к перееданию. В отчете 23andme есть rs1726866, который согласно работе в журнале Appetite, влияет на переедание. Результаты исследования показали, что испытуемые с AG, скорее, не склонны ни к перееданию ни к недоеданию, у испытуемых с GG наблюдалась склонность к недоеданию, у испытуемых с AA - склонность к перееданию. В исследовании принимала участие 381 женщина европейского происхождения. Далеко не факт, что результат можно перенести на мужчин.
Также у людей с A в rs1726866, согласно 23andme, наблюдается снижение в восприятии вкуса горького. На переедание могут влиять много других факторов, так что не принимаем результаты близко к сердцу, но принимаем во внимание.

Еще 23andme в своем отчете посвященному особенностям здоровья приводит следующие SNPы, которые, согласно научным трудам в солидных журналах, влияют на ИМТ:

rs6548238 CT - ИМТ в среднем ниже на 0,26 единицы
TT - ИМТ в среднем ниже на 0,52 единицы
CC - обычный ИМТ
Данные 56 082 европейцев.

rs925946TT - ИМТ в среднем на 0,35 единиц выше
GT - обычный ИМТ
GG - ИМТ в среднем на 0,35 единиц ниже
Данные 5800 европейцев.

rs7138803AA - ИМТ в среднем на 0,41 единиц выше
AG - обычный ИМТ
GG - ИМТ в среднем на 0,41 единиц ниже
Данные 5829 европейцев.

rs9939609AA - ИМТ в среднем на 0,33 единиц выше
AT - обычный ИМТ
TT - ИМТ в среднем на 0,33 единиц ниже
Данные 59 082 европейцев.

rs13130484TT - ИМТ в среднем на 0,19 единиц выше
CT - обычный ИМТ
CC - ИМТ в среднем на 0,19 единиц ниже
Данные 59 082 европейцев.

rs4788102AA - ИМТ в среднем на 0,15 единиц выше
AG - обычный ИМТ
GG - ИМТ в среднем на 0,15 единиц ниже
Данные 59 082 европейцев.

rs10838738GG - ИМТ в среднем на 0,07 единиц выше
AG - обычный ИМТ
AA - ИМТ в среднем на 0,07 единиц ниже
Данные 59 082 европейцев

rs10871777GG - ИМТ в среднем на 0,44 единиц выше
AG - ИМТ в среднем на 0,22 единиц выше
AA - обычный ИМТ
Данные 77 228 европейцев

В следующем исследовании найдена зависимость окружности талии от значения в rs12970134:
rs12970134AA - окружность талии, в среднем выше на 0,88 см
AG - обычная окружность талии
GG - окружность талии, в среднем ниже на 0,88 см
Данные 14 639 азиатов и европейцев
Есть и другие SNPы, также, согласно исследованиям, влияющие на ИМТ. Посмотрев на все это, может сложиться мнение, что наше здоровье определяется в основном генетикой, но это далеко не так. Безусловно генетика вносит значительный вклад в наше здоровье, но не менее значительный вклад вносит наш образ жизни и окружающая среда в месте обитания. Какие бы ни были результаты по упомянутым SNPам, все-таки наше здоровье в наших руках. Вне зависимости от ваших генов, очень важно заниматься спортом.


Согласно различным исследованиям, занимаясь фитнесом, вы значительно снижаете вероятность различных заболеваний, включая онкологические, и конечно, это помогает контролировать вес. Есть научные свидетельства, что окружающая среда или суровые условия, в которые поставлен организм, могут менять то, как организм интерпретирует код ДНК в различных клетках.
Например, в работе, опубликованной в PLoS Genet, выявлено, что 6 месяцев упражнений повлияло на модификацию ДНК в жировых тканях таким образом, что в клетках изменился метаболизм. При этом были модифицированы многие гены, связанные с диабетом второго типа и ожирением. Как нетрудно догадаться, изменения были в лучшую сторону...
Все, бегом в спортзал.

суббота, 21 марта 2015 г.

Как работает геном

Изучив, что представляет геном, надо разобраться как он работает.
Рассмотрим сначала пример как геном определяет группу крови. Думаю, все видели вот такую картинку:

и многие знают, что это красные кровяные тельца - эритроциты. В крови эритроциты выполняют транспортную функцию. Переносят кислород и углекислый газ к и от  различных органов. На поверхности эритроцитов могут присутствовать молекулы - антигены, их обозначают обычно "A" и "B". Протеины (в этом случае они же ферменты они же энзимы просто разные названия) регулируют какой именно антиген находится на эритроцитах.
Отсутствие антигенов A и B на эритроцитах определяет первую группу крови. Наличие антигена A при отсутствии B определяет вторую группу крови. Если есть только B - третья группа крови, и если есть оба антигена A и B - у человека четвертая группа крови. В англоязычных источниках протеин, который регулирует какой антиген присутствует на поверхности эритроцитов и, как следствие, определяет группу крови называется ABO enzyme - я буду называть его ABO энзим, т.к. пока не нашел как принято называть этот протеин на русском.
Но причем тут геном? В случае с группой крови наш геном имеет что-то вроде рецепта, по которому организм готовит ABO энзим. Таким рецептом является последовательность нуклеотидов в участке генома. И мы плавно подошли к понятию гена. Ген это участок генома отвечающий за производство организмом чего-либо - в нашем случае протеина (ABO энзима). Можно провести аналогию, если ген это рецепт, то весь геном это книга рецептов, по которой организм готовит составляющие, определяющие наши особенности. Про гены говорят, что они являются кодирующими участками генома - кодируют протеины. В нашем геноме также есть некодирующие участки.
Ген, кодирующий ABO энзим, называется ABO. В разделе raw data 23andme вы можете детально посмотреть какими нуклеотидами представлен этот ген у вас. Вбиваем ABO в поле jump to a gene и жмем Go:

А как именно ДНК влияет на производство протеинов в организме?
В клетках нашего организма помимо ядер и митохондрий, о которых уже немного известно из предыдущего поста, содержится еще много различных составляющих. Из всех них нас сейчас будут интересовать рибосомы. Рибосомы выполняют в клетке функцию создания протеинов.


На картинке рибосомы указаны под номером 3 - небольшие кружочки. По номером 9 на картинке уже знакомые митохондрии, 2 - ядро клетки. Остальные составляющие нас тут не интересуют.

Теперь о том, как ДНК, находящееся в ядре, дает понять рибосомам какой протеин делать. ДНК хромосом никогда не покидает ядро клетки даже при делении. Чтобы передать информацию от ДНК к рибосомам используется промежуточная молекула - (рибонуклеиновая кислота) РНК, которую можно назвать младшей сестрой ДНК. Процесс переноса информации от ДНК к рибосомам происходит в результате следующих шагов:
1 В ядре создается копия интересующего клетку участка ДНК. Копия создается в виде РНК, которую мы рассмотрим подробнее позже.
2 Созданный участок РНК покидает ядро
3 Рибосомы по РНК создают протеины
Эти три процесса, вернее их последовательность (ДНК->РНК->Протеины), известны как центральная догма молекулярной биологии. Схематично процесс получения протеинов показан на картинке.



Возможно у вас появились вопросы, что-то стало не совсем понятно - не переживайте все прояснится далее, когда мы рассмотрим немного глубже РНК и гены.
В завершении поста отмечу, что участков ДНК, отвечающих за кодирование протеинов, в нашем геноме всего 1-2%. Удивлены?

воскресенье, 15 марта 2015 г.

Внутренние часы в ДНК, которые предскажут сколько нам осталось

Отвлечемся на время от изучения нашего генома и посмотрим что ДНК говорит о продолжительности жизни и старении организма. Из моего предыдущего поста вы примерно представляете, что такое теломеры - участки на концах хромосом. Согласно современным представлениям, теломеры это что-то вроде крышек на концах хромосом, ограничивающих присоединение хромосом друг к другу и к различным участкам ДНК.


Многие современные исследования утверждают, что от длины теломер зависит наша продолжительность жизни и процессы старения. Суть такая, чем теломеры длиннее, тем вы будете дольше жить и медленнее стареть. Конечно продолжительность жизни зависит не только от длины теломер, а от образа жизни, состояния окружающей среды в месте вашего проживания и т.п. Если вы живете у какого-нибудь вредного завода, постоянно курите, плохо спите, злоупотребляете алкоголем, даже самые длинные теломеры вас не спасут.


Однако есть несколько интересных исследований и фактов, что теломеры все-таки на что-то влияют.
Во-первых, при рождении теломеры младенцев длиннее, чем у старших. С возрастом теломеры постепенно уменьшаются в размере. Уменьшение происходит с каждым делением клеток, и в конце концов, когда теломеры слишком короткие, клетка становится не способна к делению и умирает. При рождении длина теломер составляет примерно 8 000-13 000 пар нуклеотидов и уменьшается на 20-40 пар каждый год.
Во-вторых, отмечается, что короткие теломеры приводят к болезням костного мозга, печени, легких и кожи.
В-третьих, у женщин теломеры длиннее, чем у мужчин. А продолжительность жизни у женщин, как известно, выше чем у мужчин.


В-четвертых, исследования продолжительности жизни близнецов показали, что у брата/сестры с более короткими теломерами вероятность умереть первым выше в три раза.
Разумеется, ученые попытались увеличить длину теломер искусственно, причем довольно успешно. Однако, к сожалению, это не привело к положительному эффекту. В клетках с увеличенными теломерами развился рак.
Получается, для нормальной жизни клеток теломеры не должны быть слишком длинными или слишком короткими, а чем-то между.
Курение и ожирение приводят к уменьшению длины теломер, так что, надеюсь, многие, дочитав до сюда, сразу бросят курить и побегут в спортзал.
Еще одна интересная особенность, отмеченная в блоге 23andme, касается влияния возраста отца во время зачатия на длину теломер ребенка. Оказывается, что чем старше отец, тем длиннее будут теломеры ребенка. С одной стороны, конечно новость хорошая, с другой "старые" отцы имеют больше мутаций в своем геноме, что сопряжено с определенными рисками для ребенка и перевешивают положительный вклад длинных теломер.


Теперь посмотрим на практике, что говорит ДНК о длине теломер и продолжительности жизни. Есть несколько исследований, связывающих SNP rs10936599, rs2736100, rs9420907, rs755017, rs11100479 и rs10165485 с длиной теломер и, соответственно с процессами старения.
В личном кабинете 23andme идем в Raw Data и смотрим приведенные SNPы
1 rs10936599
CC - обычная длина теломер CT - укороченные теломеры, такие же как у человека на 3,91 года старше вас, но с обычной длиной теломер, TT - укороченные теломеры такие же как у человека на 7,82 лет старше вас, но с обычной длиной теломер. Исследование проводилось на данных 36 000 европейцев и опубликовано в Nature Genetics.


rs2736100
AC - обычная длина теломер, CC - длинные теломеры, в среднем такие же, как у человека младше на 3,14 года с AC в этом SNP, AA - короткие теломеры в среднем такие же, как у человека старше на 3,14 года с AC в этом SNP. В исследовании, опубликованном в том же Nature Genetics, анализировали данные 25 800 европейцев.
rs9420907
AA - обычная длина теломер, AC - длинные теломеры, как у человека с AA но младше вас на 2,76 года, CC - длинные теломеры, как у человека с AA но младше вас на 5,52 лет.
Исследовали данные 37 600 европейцев, опубликовали в Nature Genetics
rs755017
в 23andme этого SNP на чипе нет, но если вы знаете для него свои данные, то:
AA - обычная длина теломер, AG - теломеры длиннее как у человека с AA, но младше на 2,47 года, GG - теломеры длиннее как у человека с AA, но младше на 4,94 года.
Данные от 37 100 европейцев, опубликовано в Nature Genetics.
rs11100479
TT - обычная длина теломер, CT - короткие, длина как у человека на 2,99 года старше, но с TT, CC - короткие, длина как у человека на 5,98 лет старше, но с TT.
Данные от 34 600 европейцев, журнал Nature Genetics
rs10165485
TT - обычная длина теломер, CT - длинные, длина как у человека с TT, но моложе на 2,23 года, CC - длинные, длина как у человека с TT, но моложе вас на 4,46 лет.
Проанализированы данные 37 600 европейцев, журнал Nature Genetics.
Кстати у всех упомянутых статей один автор.
Опять же, не стоит относится серьезно к этим данным, каковы бы ни были ваши значения, самое важное это то, какой вы ведете образ жизни и в каком месте живете. Исследования влияния длины теломер на процессы старения и продолжительность жизни продолжаются.
Еще пару интересных SNP, которые не связаны с теломерами, но связаны с продолжительностью жизни: rs2542052 и rs2764264.
Исследования с rs2542052 рассматривали данные 213 евреев Ашкеназов в возрасте от 95 до 107 лет. Данные как-то сравнивались с более молодыми представителями. Не читал оригинальные статьи (раз и два), поэтому деталей исследований не знаю. Суть такая, если у вас в этом SNP CC, у вас больше вероятность дожить до 100 и выше, если что-то другое, то обычная вероятность.
В исследованиях, где фигурировал rs2764264, сравнивали данные 213 мужчин японцев старше 95 лет с данными 402 японцев не доживших до 81. Если у вас в этом SNP CC, вероятность дожить до 95 и старше больше чем у людей с CT и значительно больше чем у людей с TT. Отмечу, что т.к. исследовали японцев, возможно данные применимы к вам если вы азиат.