четверг, 7 июля 2016 г.

Опыт заказа ancestry DNA

После недавних комментариев о том, что компания 23andme перестала принимать наборы, присланные не из страны, в которую они покупались, я решил попробовать сделать генетический тест так, будто я нахожусь в США. А именно заказать набор на американский адрес и отправить его в лабораторию по входящей в комплект предоплаченной доставке.
Так как, результаты 23andme у меня уже есть, причем как для меня так и для моих родителей и некоторых родственников, я решил попробовать тест ancestryDNA. Сразу оговорюсь, способ, который я тут раскрою, не сработает с 23andme, но с ancestryDNA у меня все прошло гладко.
Был приятно удивлен, что база ancestryDNA больше 23andme, считав до этого последнюю абсолютным лидером на рынке ДНК тестов.
Пара слов о компании ancestry.com, продуктом которой является ancestryDNA:
Ancestry.com это самая большая компания, предоставляющая генеалогические услуги, в мире, дислоцируется в штате Юта, который многим известен мормонами. Мормоны это представители церкви Иисуса Христа и святых последних дней (LDS), приходы которой находятся по всей России. Вы могли встречать миссионеров-мормонов на улице, обычно это молодые люди или девушки 19-24 лет, приезжающие на два года из США чтобы проповедовать.
История ancestry.com тесно связана с церковью LDS - так, первый продукт компании основан на записях мормонов, очень трепетно относящихся к своей генеалогии.
В данный момент, судя по сайту, база ancestryDNA насчитывает более 2 миллионов образцов, что весьма внушительно.
Помимо ancestryDNA, компания предоставляет продукты для генеалогических исследований. По платной подписке вы получите доступ к куче всевозможных баз, например, переписям населения в США, базам натурализации, смертей, браков и многих многих других. Базы постоянно обновляются.
Заказ теста
Тест ancestryDNA стоит 99 долларов, в отличие от 199 долларов для 23andme. Пройдя по этой ссылке, вы сможете купить ancestryDNA за 89 долларов.
При заказе набора в страну не из этого списка: 
придется воспользоваться почтовым форвардером. Я для этих целей, как и для отправки обратно, использовал shipito.com
После регистрации в shipito.com у меня появился почтовый адрес в США, на который я и заказал набор ancestryDNA. Чтобы отправить набор в Россию из шипито использовал доставку Boxberry Local Pickup, которая мне обошлась в 23 доллара.
Набор 23andme через почтовых форвардеров заказать нельзя, т.к. судя по постам с форума molgen, компания не отправляет тесты на их адреса, однако можно попробовать услугу "помощь в покупке" -> "покупка через посредника" в shipito.
Прохождение теста
Набор ancestryDNA включает пробирку со штрих-кодом, который необходимо ввести в своем личном кабинете на dna.ancestry.com, тем самым привязав образец к своему аккаунту, инструкцию по выполнению теста, небольшую коробку с предоплаченной доставкой и полупрозрачный пакетик с куском адсорбера.
Процедура сбора анализа очень проста - минимум за 30-60 минут до сбора слюны нельзя есть, пить, курить, жевать жвачку и вообще лучше ничего не класть в рот. После такого "воздержания" надо поплевать в пробирку, чтобы слюна дошла до указанного уровня. Дальше нужно закрыть пробирку идущим в комплекте колпачком, в котором находится консервирующая слюну жидкость.
В отличие от 23andme, на наборе ancestryDNA я не нашел информации о сроке годности или дате выпуска пробирки.
Отправка теста в лабораторию в США
Чтобы послать набор обратно из России и симулировать отправку из США я сделал следующее:
сначала я отправил коробку с пробиркой на свой американский адрес в шипито, затем когда моя слюна дошла,
заказал на шипито специальный запрос следующего содержания:
1 Open the blue envelope.
2 You will find a small white box with USPS shipping label on it inside the blue envelope.
3 Return the box with the USPS shipping label provided
За два дня мой запрос выполнили, цена обработки составила 12 долларов - 5 долларов специальный запрос + 2 доллара обработка отправления + 5 долларов - ускоренная обработка.
И через день после выполнения запроса я наблюдал путешествие посылки по США от шипито в лабораторию в Юте.
Примерно через 2 дня после того, как согласно трек-номеру посылка была доставлена, мне пришел имейл от ancestry:
Теперь в своем аккаунте я вижу следующую картинку:
Резюме
Итого на тест я потратил:
134 доллара (99 сам набор + 23 отправка в Россию + 12 обработка специального запроса)
1500 рублей отправка EMS почтой на свой адрес в шипито.
Всего (по курсу 66 рублей за доллар) - 10 344 рубля.
Можно сэкономить 5 долларов на специальном запросе и не делать его ускоренным, также 10 долларов можно сэкономить, заказывая тест по ссылке, ну и отправлять в Америку можно было обычной почтой за 500-600 рублей.
Итого, проходя тест максимально экономно, можно уложиться в 8400 рублей.
По времени, с момента оплаты мной набора до имейла, что пробирка получена прошло 56 дней. Однако я не особо торопился отправлять набор на разных этапах его путешествия.
Думаю, если стараться все делать очень быстро, можно уложиться в 40-45 дней.
Ждем первых результатов теста...

воскресенье, 1 ноября 2015 г.

Сайт 22andxy расшифровка результатов генетических тестов

Давно сюда не писал - был занят созданием сайта для расшифровки 23andme.
На днях 23andme заявила, что возобновит предоставление результатов по здоровью для своих клиентов, однако результаты будут не столь полны как раньше т.к. FDA разрешила давать данные только по определенным заболеваниям. Цена теста подскочила до 199 долларов.
Я давно хотел сделать сайт по расшифровке, аналогичный promethease или athletigen только на русском языке и чтобы можно было использовать результаты не только 23andme но и других фирм. И вот мой сайт начал работать. Конечно пока там не так много контента и программная часть не совсем удобная, да и дизайн оставляет желать лучшего, но главное - начало положено. Буду по мере возможности что-то исправлять и улучшать.
В примере расшифровки можно посмотреть по каким SNP, что определяется. Если зарегистрироваться, и в разделе "Мое ДНК" вручную указать генотип в некоторых своих SNP, то в "ДНК особенности" появится таблица, как в примере расшифровки только для вас.
О всех ошибках, неточностях, пожеланиях и предложениях пишите мне в группу или в комментарии к этому посту.
Также начал записывать видео на youtube с обзорами 23andme, планирую развить канал на тему генетики.
Пока видео конечно скучноваты, но я думаю, как сделать следующие записи веселее)


вторник, 1 сентября 2015 г.

Генетика ожирения: не за горами генная терапия против лишнего веса

Говоря об ожирении, в основном все вспоминают США. И, конечно, не зря, в этой стране граждане с лишним весом составляют примерно 1/3 от всего населения, тогда как в России примерно 1/4, что тоже очень много. Ожирение сокращает продолжительность жизни, увеличивает вероятность диабета и сердечных заболеваний. Думаю, многие ждут чудес от генетической инженерии, которая, безусловно, поможет нам справляться с лишним весом быстро и естественно, и предпосылки к чудесам постепенно начинают появляться...


В данный момент найдено несколько генов, возможно отвечающих за склонность к избыточному весу. Открытый в 2007 ген FTO (fat mass and obesity associated - переводится как "связанный с количеством жира и ожирением") активно исследуется, т.к. согласно многим трудам, именно он бесспорно влияет на склонность к ожирению.
На сегодняшний день пока не ясен механизм по которому FTO влияет на избыточный вес. Некоторые ученые полагают, что ген регулирует склонность к обжорству и потреблению высококалорийной пищи и вообще, что ген как-то влияет на наш мозг, который принимает решения, приводящие к ожирению. В исследовании "Cohort of birth modifies the association between FTO genotype and BMI" установили что FTO по разному определяет склонность к ожирению у людей родившихся до и после Второй Мировой. Одним из возможных объяснений является то, что до Второй Мировой люди были более подвижны и всё негативное влияние гена FTO за счет физической активности значительно снижалось.
И вот недавно совместными усилиями ученых из Harvard и MIT мы, возможно, немного приблизились к пониманию как работает FTO. Как показало их исследование, неблагоприятная версия гена FTO способствует сохранению энергии из пищи в клетках в виде жира.
Участки FTO регулируют деятельность генов IRX3 и IRX5, которые, если включены, заставляют клетки сохранять энергию. Если IRX3 и IRX5 не работают, вероятность ожирения снижается. Из полученных данных следует, что для некоторых людей вероятность избыточного веса определяется не их особенностями диеты или тем, как активно они занимаются спортом, а именно склонностью клеток сохранять жир.


С помощью современных технологий можно искусственно отключить IRX3 и IRX5 и, теоретически включить механизм сжигания жира в клетках. Эксперименты на мышах показали, что вес животных с включенным IRX3 при высококалорийной диете на 15% выше, чем у подопытных с выключенным геном. Все это дает надежду, что скоро лишние килограммы можно будет убрать уколом или таблеткой, стимулирующими естественное сжигание жира.
Проверить активность IRX3 и IRX5 по данным 23andme можно с помощью rs1421085.
Каждая копия C увеличивает активность вредных генов.

вторник, 25 августа 2015 г.

23andme и тесты на отцовство

Одним из популярных поисковых запросов на тему генетических тестов является "тест на отцовство".



Но можно ли использовать услугу 23andme или подобной компании, например ftdna, для определения отцовства? Как определить отцовство дешевле и быстрее всего и насколько можно верить результатам? На эти вопросы я и попробую ответить в этом сообщении.
Вообще чтобы определить являются ли два человека родственниками, необходимо сравнить их ДНК хромосому за хромосомой. Если какой-то минимальный процент совпадает, то людей можно считать родственниками. Какой именно минимальный процент указывает на родственную связь - пока, думаю, не до конца разрешенный вопрос. В 23andme у моего самого дальнего потенциального родственника 0.12% общей по тесту со мной ДНК, тогда как с моим самым близким родственником, прошедшим тест - моей мамой у меня совпадает 50%. Но все наше ДНК это 3 миллиарда пар нуклеотидов, определить какой нуклеотид находится в каком месте во всех 3 миллиардах позиций очень дорого. 23andme и подобные дают сводку по нескольким миллионам позиций генома (конкретно 23andme укажет нуклеотиды в 5 миллионах позиций генома).
Компании, занимающиеся непосредственно тестами на отцовство, сравнивают определенные участки ДНК - маркеры. Если маркеры совпадают, делается соответствующее заключение о родстве.
Традиционные способы установления отцовства отличаются по количеству рассматриваемых маркеров. Наиболее популярными методами установления отцовства являются "полимеразная цепная реакция (ПЦР)" и "полиморфизм длин рестрикционных фрагментов (ПДРФ)", хотя есть конечно и много других.
ПЦР современнее и быстрее ПДРФ. Обычно ПЦР занимает 3-9 дней и требует небольшое количество ДНК-материала для опыта - можно использовать мазок с внутренней стороны щеки, любые клетки, однако при этом способе сравниваются участки ДНК небольшого размера и тестируется обычно 6-9 участков ДНК, что меньше чем у ПДРФ.
ПДРФ более достоверный чем ПЦР метод установления отцовства, но он требует больше генетического материала, поэтому тут, возможно, придется сдавать кровь, хотя современные технологии ПДРФ позволяют сделать тест и по мазку с внутренней стороны щеки. ПДРФ обычно занимает 10-14 дней.
Конечно фирмы, предоставляющие тесты на отцовство, могут и не называть вам применяемого метода, но если тест занимает меньше 10 дней и кровь не требуется, скорее всего, применяется менее точный ПЦР.
Точность определения отцовства в 23andme и подобных составляет 100% - вы можете сравнить каждую хромосому и увидеть сколько процентов ДНК совпадает. Для родитель-ребенок совпадает 50% ДНК, бабушка/дедушка-внук совпадает 25% ДНК. Короче для ближайших родственников определить родство можно очень точно, относительно быстро и за ту же цену, что нельзя сказать о традиционных способах определения родства. Точность тут снижается а цена повышается.


Если вы хотите предварительно прикинуть являются ли два человека родителем и ребенком, можно рассмотреть группу крови исследуемых лиц. В таблице показаны возможные группы крови ребенка при различных сочетаниях групп крови отца и матери. Если у потенциальных матери с отцом первая группа крови, а у ребенка вторая, то, скорее всего, надо рассмотреть другого потенциального отца или мать. Если у потенциальных родителей первая и вторая группы крови, тут без теста на отцовство не разобраться, т.к. у ребенка может быть любая группа.
Группа крови ребенка
Группа крови отца
II(A) III(B) IV(AB) I(O)
Группа крови матери
II(A) A/O A/B/AB/O A/B/AB A/O
III(B) A/B/AB/O B/O A/B/AB B/O
IV(AB) A/B/AB A/B/AB A/B/AB A/B
I(O) A/O B/O A/B O

Рассмотрим, представленные на рынке, фирмы, определяющие отцовство.
Сравнивать различные компании, оказывающие услуги установления отцовства, будем по следующим критериям:
-Цена
-Скорость выполнения
-Предоставление юридически значимых документов по результатам теста - очень важно для всяких судов
-Анонимность - можно ли сделать тест без ведома потенциального ребенка или отца - важно, например, для мам, которые не уверены точно от кого родили, но не хотят выставлять свои сомнения напоказ
-Распространяемость - насколько можно распространить результаты на другие отрасли, тут безусловными лидерами будут 23andme и ftdna.
Сравнивать будем следующие фирмы:
-23andme
-ftdna
-инвитро - на мой взгляд, довольно дорогая компания, но отделения есть по всей России и Украине.
-Диалайн - Волгоградская фирма установления отцовства - думаю похожая есть в любом другом городе.
С нынешним курсом доллара выигрывает типичная фирма типа диалайн, оказывающая услуги теста на отцовство. Со стороны юридической применимости ДНК теста любая отечественная фирма предлагает необходимые для суда документы, тогда как в 23andme и ftdna можно получить только информацию. Хотя на сайте ftdna предлагается воспользоваться услугами dnafindings, полученные в которой документы, можно применить в международных спорах.
Что касается анонимности, на рынке можно найти анонимный тест в российской фирме в пределах 20 -25 тыс. руб. в зависимости от региона. Видимо из-аз страха перед определенными законами, в диалайн отказываются делать тест по генетическому материалу, отличному от крови, но, полагаю, это исключение. 23andme и ftdna предоставляют средний уровень анонимности - вы не можете отправить на тест волос или окурок, нужно взять пробу слюны или мазок с внутренней стороны щеки, что не всегда можно сделать, не вызывая подозрений. Также при проведении теста 23andme или ftdna, вы получаете данные, которые можно использовать и для определения особенностей здоровья и для поиска родственников плюс, если придется столкнуться с определением отцовства повторно, например когда у ребенка 3 потенциальных отца, можно сделать тест для ребенка и для кого-то из возможных отцов, если результат окажется отрицательным,  доплатить 100$, сделав тест для второго возможного отца - не надо платить несколько раз по 20 тыс. руб.
Результаты сравнения сведены в таблицу.

23andme ftdna инвитро диалайн
Цена* 230$ 200$ 40-60 тыс. руб. 15-30 т.р.
Скорость
выполнения
1.5-2 месяца 2-2.5 месяца ускоренный -
до 8 дней
до 30 дней
Юридическая
применимость
Нет Есть, но на отдельном
сайте за отдельную плату (425$),
в РФ скорее всего
неприменимо
Есть Есть
Анонимность Средняя Средняя Высокая,
по необходимости
Нет
Распространяемость Высокая Высокая Отсутствует Отсутствует

*Цены указаны на август 2015

Вообщем оставайтесь верными друг другу, чтобы вопрос отцовства вас не волновал.

воскресенье, 2 августа 2015 г.

Интеллект определяет продолжительность жизни

Научные исследования на тему умственных способностей показывают, что у людей с высоким уровнем интеллекта выше продолжительность жизни. Однако пока не до конца ясна причина такой корреляции. Возможно умные люди имеют социальный статус, который позволяет им лучше следить за здоровьем, а возможно что в таком совпадении замешана генетика, влияющая и на интеллект и на долголетие, а может вообще все сразу. 
Причину корреляции и попытались выяснить авторы недавно опубликованной научной статьи "The association between intelligence and lifespan is mostly genetic".
Исследуя однояйцевых и многояйцевых однополых близнецов, ученые выяснили, что связь между интеллектом и продолжительностью жизни на 95% регулируется генами.


После анализа данных было установлено, что более смышленый близнец обычно живет дольше. Причем данная тенденция была более явной у многояйцевых близнецов.
Тем не менее связь между интеллектом и продолжительностью жизни хоть и есть, но очень мала, поэтому при наличии большого IQ не спешите обзаводиться вредными привычками.
Автор работы Rosalind Arden считает, что гены делающие нас умнее, делают нас более здоровыми.
Безусловно, требуются дальнейшие исследования для установления деталей явления.
23andme предоставляет следующий SNP для характеристики интеллекта:
rs363050 - AG - обычный IQ, AA - IQ в среднем выше на 3-4 пункта, GG - IQ на 3-4 пункта ниже чем у AG. 
Авторы исследования, где участвовали данные rs363050 оценили влияние данного параметра на разброс в значениях IQ всего в 3,4%, поэтому серьезно к этим данным относиться не стоит. Исследовались данные индивидов с европейским происхождением.

суббота, 11 июля 2015 г.

Крейг Вентер

Как я уже писал, за последние 20 лет в генетике произошли мало освещаемые открытия по значимости сопоставимые с полетом человека в космос или на Луну. Тут есть и свои малоизвестные Гагарины с Армстронгами.
Одним из известных ныне здравствующих деятелей в области генетики является Craig Venter. Этот человек был в числе ученых, участвовавших в первом в истории секвенировании генома живого организма в 1995. Секвенировали тогда геном гемофильной палочки а также геном организма Mycoplasma genitalium.


Кроме того, Venter принимал участие в приближении первого секвенирования человеческого генома, которое окончательно было выполнено к 2003.
После 2003 Venter в рамках всемирной экспедиции по исследованию ДНК мирового океана (Global Ocean Sampling Expedition) занимался изучением разнообразия геномов организмов, обитающих в мировом океане. Экспедиция была анонсирована самим Вентером в марте 2004. От берегов Канады стартовала принадлежащая ученому яхта, которая, сделав кругосветное путешествие, вернулась к берегам США в январе 2006. По пути экспедиция брала образцы живых организмов из океана и секвенировала их геномы.
С 2006 этот предприниматель/ученый возглавляет институт имени себя (J. Craig Venter Institute), в котором занимаются различными исследованиями в области генетики.
С марта 2014 года Вентер совместно с Peter Diamandis и Robert Hariri основали компанию "Человеческое долголетие" (Human longevity). Цель компании состоит в повышении продолжительности жизни и работоспособности человека.
Короче говоря, Вентер очень яркая персона в мире ДНК.
Теперь особенно крутые достижения Вентера. В 2003 году ученый с коллегами за 14 дней воссоздали ДНК вируса Phi X 174. Полученную ДНК ввели в бактерию, тем самым имитируя заражение клетки, которая создала вирус Phi X 174. Образовавшийся вирус вел себя как настоящий - размножился и убил все бактерии в исследуемом пространстве. Геномы вирусов синтезировали и до 2003 года, но обычно такой синтез занимал несколько лет и полученные последовательности имели ошибки.


Следующим прорывным успехом Вентера стало создание "синтетической клетки" в 2010. Суть успеха состояла в замене оригинального генома в клетке Mycoplasma capricolum на полученную синтетическим путем ДНК. Организм, полученный в результате эксперимента, был назван Mycoplasma laboratorium.
Синтетическая ДНК незначительно отличалась от оригинальной - в ней содержались "водяные знаки" - зашифрованные в коде ДНК имена 46 ученых, принимавших участие в эксперименте, таблица для алфавита, в котором были зашифрованы сообщения, три цитаты и секретный адрес электронной почты бактерии. "Водяные знаки" (watermarks) использовались чтобы в последующем убедиться, что в бактериях было именно синтезированное ДНК, а не естественное, которое могло попасть в клетку случайно.
Вот 3 цитаты, зашифрованные в коде искусственной ДНК:
  1. Жить, ошибаться, терпеть неудачи, побеждать, воссоздавать жизнь из другой жизни. (TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE) -- James Joyce.
  2. Видеть вещи не такими, какие они есть, а такими, какими они могли бы быть. (SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE) -- из книги American Prometheus.
  3. То, что я не могу построить - не могу и понять. (WHAT I CANNOT BUILD, I CANNOT UNDERSTAND) -- Ричард Фейнман.
Успех пересадки искусственной ДНК в клетку трудно переоценить. Своим достижением Вентер с коллегами дали человечеству инструменты для создания новых организмов, которые, например, можно использовать для получения топлива или для очистки чего угодно от чего угодно и для всего, что только можно вообразить. Одним из направлений деятельности Вентера сейчас как раз является создание таких организмов.
В книге Вентера "Жизнь со скорость света" (Life at the speed of light) ученый рассказывает про "биологическую телепортацию". Смысл явления состоит в том, что на одном конце (например на Марсе) мы имеем ДНК секвенатор с передатчиком, а на другом (например на Земле) имеем приемник с устройством для создания ДНК по полученной приемником последовательности. Предположим на Марсе робот нашел жизнь - каких-то микробов. Чтобы отправить фрагмент ДНК с Марса на Землю потребуется куча денег и минимум несколько недель. Вместо этого ДНК секвенатор секвенирует геном найденного организма, компьютер шлет полученную последовательность ДНК на Землю, где ученые, возможно, смогут воссоздать организм по последовательности ДНК. Операция пересылки ДНК как информации займет несколько минут и ее цена будет ничтожна по сравнению с доставкой целого марсианского фрагмента на Землю.


Сейчас Вентер работает над увеличением продолжительности здоровой жизни человека. К 2020 Вентер в рамках одного из проектов планирует секвенировать 1 миллион человеческих геномов, которые помогут нам глубже понять природу различных болезней.
Имя ученого в виде CRAIGVENTER, зашифрованное в геноме Mycoplasma laboratorium, представляет следующую последовательность нуклеотидов:
TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA

пятница, 19 июня 2015 г.

23andme и первый миллион клиентов

Сегодня на почту пришло письмо, подписанное одной из основательниц 23andme Анне Войжитски, которое радостно сообщало, что на прошлой неделе 23andme провела генетический тест для своего миллионного клиента.
В письме меня поздравили, что я являюсь частью того миллиона, который способствует изменению мира. Было очень приятно.
Также сообщение приводило несколько фактов о времени когда еще не был протестирован ни один клиент 23andme.
Миллион протестированных клиентов назад участники конференции "American Society of Human Genetics" были шокированы сообщением о генетическом тесте, который бы давал информацию пациенту напрямую.
Миллион протестированных клиентов назад не было известно как люди прореагируют на информацию из генетических тестов. Как показывают исследования, пользователи тестов не реагируют на свои результаты слишком остро.
Миллион протестированных клиентов назад не было законов, регулирующих доступ к персональной генетической информации. Сейчас такие законы появились во многих странах.

Меня также порадовали, что в протестированном миллионе я стою по номером 794,981.


Кто находится под номерами от 1 до 100 пока загадка, единственное что известно - Анне Войжитски под номером 60.